8

of 5
9 views
PDF
All materials on our website are shared by users. If you have any questions about copyright issues, please report us to resolve them. We are always happy to assist you.
Document Description
376 Asian Pacific Journal of Tropical Biomedicine (2011)376-380 Contents lists available at ScienceDirect Asian Pacific Journal of Tropical Biomedicine journal homepage:www.elsevier.com/locate/apjtb Document heading doi:10.1016/S2221-1691(11)60083-X Analytical characterization and structure elucidation of metabolites from Aspergillus ochraceus MP2 fungi Meenupriya J1, Thangaraj M2 1 2 Department of Biotechnology, Sathyabama University, Chennai-119, India CAS in Marine biology, Annamalai u
Document Share
Document Tags
Document Transcript
  376 Document heading doi:10.1016/S2221-1691(11)60083-X Analytical characterization and structure elucidation of metabolites from  Aspergillus ochraceus MP2 fungi Meenupriya J 1 , Thangaraj M 2 1  Department of Biotechnology, Sathyabama University, Chennai-119, India 2 CAS in Marine biology, Annamalai university, Parangipettai- 608 502, India Asian Pacific Journal of Tropical Biomedicine (2011)376-380 Asian Pacific Journal of Tropical Biomedicine  journal homepage:www.elsevier.com/locate/apjtb   * C orresponding author: J   M eenupriya, D epartment of  B iotechnology, S athyabama U niversity, C hennai- 119 , I ndia.  T el: + 91   44   24501644   E -mail: meenupriya.j@gmail.com 1. Introduction   M any marine invertebrates produce natural compoundsthat affect the growth, metabolism, reproduction, andsurvival of other types of organisms. H ence, they areconsidered to be bioactive. T hose include potentiallyeffective therapeutic agents with antiviral, antibacterial,and antitumor properties produced by invertebrates fromthe classes P orifera, C nidaria, M ollusca, E chinodermata, B ryozoa, and U rochordata. C lose relations between marineinvertebrate species and microorganisms, includingsymbiotic associations and interactions during larvalsettlement, have been characterized and this providesinsights to the regulation of host-symbiont-microbialcommunity interactions. M any of the compounds isolatedfrom marine organisms, such as sponges, may be producedby associated microbes. M arine sponges are benthic animalsfound in the widerange of marine environments. T hediversity of sponges species is superior in the tropical coralreef environments. T he sponges are also very importantresources for searching the biologically active substances,which are useful to develop pharmaceuticals, agrochemicalsand biochemical reagents and their lead compounds [1] . T he srcins of these biologically active substances arerecently thought to be the metabolites produced by themicroorganisms associated with the sponges. A nd studieshave also suggested that some bioactive compounds isolatedfrom marine organisms have been shown to exhibit anti-cancer, anti-microbial, anti-fungal or anti-inflammatoryand other pharmacological activities [2-9] . T hese marineinvertebrates have evolved chemical defense mechanicsmsagainst other invading organisms, which involve theproduction of secondary metabolites [10] . S ponges are goodhomes not only for macro organisms, such as worms,brittlestars, shrimp, crabs, etc. , but also for a variety of microorganisms such as bacteria, fungi, and microalgae, ARTICLE INFO ABSTRACT  Article history: R eceived 5   M arch 2011 R eceived in revised form 4   A pril 2011 A ccepted 20   A pril 2011 A vailable online 10   M ay 2011  Keywords: M arine sponge derived fungi  Aspergillus ochraceus B ioactive metabolites A ntibacterial activity A nalytical characterization F ungi  Apergillus B ioactive secondary metabolite A ntagonistic human pathogen A ntimicrobial activity B ioactive compounds Objective: T o isolate and characterize the bioactive secondary metabolites from  Aspergillusochraceus (  A. ochraceus )   MP 2 fungi. Methods: T he anti bacterial activity of marine sponge derivedfungi  A. ochraceus   MP 2 was thoroughly investigated against antagonistic human pathogens. T heoptimum inhibitory concentration of the fungi in the elite solvent was also determined. T hepromising extracts that showed good antimicrobial activity were subjected to further analyticalseparation to get individual distinct metabolites and the eluants were further identified by GC   MS instrumental analysis. T he molecular characterization of the elite fungal strains were done byisolating their genomic DNA and amplify the internal transcribed spacer  ( ITS ) region of  5 . 8 s r  RNA  using specific ITS primer. T he novelty of the strain was proved by homology search tools and elitesequences was submitted to GENBANK . Results:   T hree bioactive compounds were characterizedto reveal their identity, chemical formula and structure. T he first elutant was identified as毩- C ampholene aldehyde with chemical formula C 10   H 16   O and molecular weight 152   D a. T he secondelutant was identified as L ucenin- 2 and chemical formula C 27   H 30   O 16 and molecular weight 610   D a. T he third elutant was identified as 6 - E thyloct- 3 -yl- 2 - ethylhexyl ester with C hemicalformula C 26   H 42   O 4   with molecular weight 418   D a. Conclusions:   T he isolated compounds showedsignificant antimicrobial activity against potential human pathogens. M icrobial secondarymetabolites represent a large source of compounds endowed with ingenious structures and potentbiological activities. Contents lists available atScienceDirect  J Meenupriya et al./Asian Pacific Journal of Tropical Biomedicine (2011)376-380 377 which live in the canals, between cells, and even insidethe cell [11] . A variety of antimicrobial substances have beenisolated from various species of marine sponges [12] . U p to 800 antibiotic compounds have been isolated from marinesponges, a number of which corroborates assumptions thatsponges appear to defend themselves against infectionsby producing and/or accumulating secondary metabolites.  Aspergillus ochraceus   (  A. ochraceus ) can produce other secondary metabolites, whose biological activity has notbeen characterized until now. T hese molecules may bebeneficial ( antibiotics ) or harmful ( mycotoxins ) to humanhealth [13-15] . F ungi isolated from marine sponge have a high creativityindex, i.e. , ability to synthesize new and interestingsecondary metabolites. A lthough the natual function is notknown, it is assumed that they play an important role inchemical defense and communication of the organism [16] . M any of them have been suggested to act as pheromones,antifeedants or repellents and regulators in the developmentof organisms. T he secondary metabolite does not occur randomly but is correlated with ecological factors [17] . N evertheless, a growing number of metabolites from sponge-derived fungal strains has been reported in the last years [18] . I t provides an overview of sponge species investigated,taxonomy of isolated fungi, and reported metabolites. T hesestructures suggest most of the metabolites to be derived frommetabolic pathways is also common to terrestrial fungi. S ucha similarity is, for example, obvious for sesquiterpenes of thehirsutane-type [16] . S tudies show that secondary metabolitesin sponges play a crucial role in their survival in the marineecosystem [26] . T hese natural products have interestingbiomedical potential, pharmaceutical relevance anddiverse biotechnological applications [18] . T he biomedicaland pharmaceutical importances of these compoundsare attributed to their antiviral, antitumor, antimicrobialand general cytotoxic properties [12] . I nterestingly, out of the 13 marine natural products that are currently under clinical trials as new drug candidates, 12 are derivedfrom invertebrates. A mong them, P orifera remains themost important phylum, as it provides a greater number of natural products, especially novel pharmacologicallyactive compounds [19] . B iochemical characteristics seem tobe useful taxonomic markers and good indicators of spongephylogeny [20] . T he diversity of biochemical properties of sponges has been demonstrated by the continued discoveryof novel compounds that have pharmacological properties [21] . 2. Materials and methods 2.1. Collection of sponge S pecimens were collected by SCUBA diving using hammer and chisel from G ulf of  M annar, located at 215 kms from K anyakumari D istrict, in the narrow strip of peninsular landalong the south east coast of  T amilnadu state. 2.2. Isolation of fungi   T he sponge sample was washed with sterile water  ( distilledwater: sea water; 1 : 1 ) and ground in a mortar and pestleunder aseptic conditions. S erial dilution was performed andfrom each dilution, plating was done in S abourauds agar byspread plate technique. T he plates were then incubated at 27   曟 for  5 days. A fter  5 days, the plates were examined and the pureculture was isolated on pure agar plate. 2.3. Molecular characterization and identification of elite fungi by ITS sequencing T he fungi were grown in culture in potato dextrose brothat room temperature in the dark for  48 to 72 hours. T hegenomic DNA was isolated and the internal transcribedspacer    ( ITS ) region of  5 . 8 s RNA was amplified using primer  ITS 1   TO   5 ’   TCCGTAGGTGAACCTGCGG   3 ’ and primer  ITS 5   5 ’   TCCTCCGCTTATTGATATGC   3 ’   7 and sequenced usingautomated sequencer. 2.4. Mass cultivation of A. ochraceousA. ochraceus   W ilhelm NRRL   3174 was grown on syntheticagar medium ( SAM ) of the following composition: 3 g/ L   NH 4 NO 3 , 26 g/ L   K 2 HPO 4 , 1 g/ L   KC l, 1 g/ L   M g SO 4 . 7 H 2 O , 10 m L  of mineral solution ( containing distilled water per litre, 70 mg N a 2 B 4 O 7 . 10 H 2 O , 50 mg ( NH 4 ) 6 . M o 7 O 24 . 4 H 2 O , 1   000 mg F e SO 4 . 7 H 2 O , 30 mg C u SO 4 . 5 H 2 O , 11 mg M n SO 4 . H 2 O , and 1   760  mg Z n SO 4 . 7 H 2 O ; the p H was adjusted to 2 with 2 mol/ L   HC l ) , 15 g agar, and 50 g/ L glucose. T he p H of the medium wasadjusted to 6 . 5 by 2 mol/ L   HC l and autoclaved at 120   曟 for  20  minutes. 2.5. Extraction process   T he fungal mycelia were homogenized using sea water. T hen the biomass was subjected to an extraction of biologically active components which were carried outwith different solvents in the order of increase polarity: C holoroform, butanol and ethyl acetate by soaking atambient temperature. T he crude extracts obtained weredried under rotary vacuum evaporator and screened for anti-bacterial activity. 2.6. Antimicrobial assay   A gar diffusion assay is used widely to determine theantibacterial activity of crude extract. T he technique workswell with defined inhibitors. N utrient agar was prepared andwas poured in the petri dish and allowed for solidification, 24 hours growing bacterial culture were swabbed on it. T hewells ( 8 mm diameter  ) were made by using cork borer. T hedifference concentration of the crude extract were loaded inthe well. T he plate was then inculated at 37   曟 for  24 hours.  D ilution assay is a standard method used to compare theinhibition efficiency of the antimicrobial agents. N utrientbroth was inoculated with 24 hours growing bacterial cultureand different concentrations of the extract were inoculated.  J Meenupriya et al./Asian Pacific Journal of Tropical Biomedicine (2011)376-380 378 B acterial culture inoculated in nutrient broth were used ascontrol. T he tubes were incubated at 37 曟 for  24 hours. T heoptimal densities were measured spectrometrically at 600  nm. T he percentage of viable cell was calculated using thefollowing formula:  %   V iable cells= C ontrol OD - T est OD 暳 100  / C ontrol 2.7. Thin layer chromatography TLC is used to separate the compound present in the crudeextract. T he separation of the compound also depends onthe usage of the solvent. T he drug with the concentration of  1 mg/m L was plotted on the TLC plate and dried. I t was thenrun with different solvent ratio the spots were identified bothin the uv light and in the iodine chamber. T he R f  value wascalculated using the formula:   R f  value= D istance travelled by the solute / D istance travelled by the solvent 2.8. Gas chromatography-mass spectrometry (GCMS)analysis   T he crude extract was quantified using gas chromatograph ( GCMS - S himadzu ) equipped with a DB - 5 ms column ( mminner diameter  0 . 25 mm, length 30 . 0 m, film thickness 0 . 25   毺 m ) mass spectrometer  ( ion source 200   曟 , RI   70 e V )  programmed at ( 40 - 650 )   曟 with a rate of  4   曟  /min. I njector temperature was 280   曟 ; carrier gas was H e ( 20 psi ) , columnflow rate was 1 . 4 m L  /min, injection mode -split. 3. Results 3.1. Isolation of fungi   I n the present study, the 10 - 5 dilution of the sponge sampleyielded three different isolates. T he characterization andanalysis was performed for  I solate   1 . P ure culture of  I solate 1   ( F igure 1 a ) was obtained and SEM micrograph ( F igure 1 b ) wastaken to visualize the morphological features of the fungi. 3.2. Molecular characterization and identification of elite fungi Table 1 Z one of inhibition of fungal filtrate in different solvents ( mm ) . P athogen  B utanol (毺 L )   C hloroform (毺 L ) E thyl acetate (毺 L ) 255075100255075100255075100  Pseudomonas ---- 1212 . 514151416 . 51819  Klebsiella ---- 1113151517192023 S. aureus ---- 1114182115172325 Table 2 W ell diffusion assay-standardization ( ethyl acetate-low concentration and high concentration ) . C oncentration (毺 L )  Klebsiella   ( mm )  Pseudomonas ( mm ) Staphylococcus   ( mm )  Micrococcus   ( mm ) L ow concentration 25 ---- 50 - 1111 - 75111212 - 1001213   1311 H igh concentration 2501211211750014162319750161823201   00019202424 Table 3 P ercentage of viable cells of  Staphylococcus and  Micrococcus in varying concentrations of ethyl acetate. C oncentration (毺 L )% of viable cells of  Staphylococcus % of viable cells of   Micrococcus 1007 . 5327 . 39920012 . 72713 . 45230013 . 76616 . 59140026 . 75318 . 16150027 . 53228 . 47560030 . 38934 . 97770046 . 23340 . 132   800 * 52 . 20746 . 188   900 ** 71 . 42854 . 4841   00075 . 06483 . 408 * MIC for  Staphyloccoccus ; ** MIC for   Microccoccus.  J Meenupriya et al./Asian Pacific Journal of Tropical Biomedicine (2011)376-380 379   T he ITS region is now perhaps the most widely sequenced DNA region in fungi, I t is most useful for molecular systematics at the species level, and even within species. I nthe present study, the DNA was isolated from the I solate 1  and the ITS region of  5 . 8 s r  RNA was amplified using specificprimers ITS 1 and ITS 4 and the sequence was determinedusing automated sequencers. B last search sequencesimilarity was found against the existing non redundantnucleotide sequence database thus, identifying the fungi as A spergillus ochraceus. T he percentage of similarity betweenthe fungi and database suggests it as novel strain. T hus,the novel strain was named as  A. ochraceus strain MP 2 andmade publically available in G en B ank with an assignedaccession number . a b Figure 1. a: P ure culture of  I solate 1 ; b: SEM micrograph of  I solate 1 . 3.3. Anti-microbial assay   T he fungi  A. ochraceus   MP 2 was extracted in three solventsof varying polarity ( B utanol, chloroform, ethyl aceteate ) . T hree human pathogens namely  Klebsiella pneumonia   ATCC   15380 , Staphylococcus aureus   ATCC   25923 ,  Pseudomonasaeruginosa   ATCC   27853 were used to test the anti-microbialactivity. T heir zone of inhibition in varying concentrations of the sample is given in T able 1 .  E thyl acetate provided promising results compared to theother solvents. T herefore, the optimum concentration of ethyl acetate producing maximum inhibition of the pathogenwas analyzed using the same well diffusion assay for bothlow concentration [ ( 25 - 100 )   毺 L ] and high concentration[ ( 250 - 1   000 )   毺 L ] of the solvent. T heir zone of inhibition is shownin T able 2 .  H igher concentration of ethyl acetate provided a better inhibition activity compared to their low concentrationcounterpart. T he minimum inhibition concentration ( MIC )  of the elite solvent was standardised for two pathogens Staphylococcus and  Micrococcus using broth dilution assayand the result is in T able 3 .  T he fungal extract subjected to TLC separation revealedthe presence of three bioactive metabolites which wasvisualised in UV short range spectrum of  254 nm ( F igure 2 a ) , UV long range of  365 nm ( F igure 2 b ) and iodine chamber  (   F igure 2 c ) .  T he TLC band was eluted and the bioactive metabolitesin the eluant responsible for the anti bacterial activity werecharacterized using GC - MS . T he chromatogram ( F igure 3 )  revealed the presence of different functional groups in theeluant and the solvent. T hree dominant compounds wereindividually characterized to reveal their identity, chemicalformula and structure. T he first elutant was identified as α - C ampholene aldehyde with C hemical formula C 10   H 16   O and molecular weight 152   D a. T he second elutant wasidentified as L ucenin- 2 with C hemical formula C 27   H 30   O 16  and molecular weight 610   D a. T he third elutant is identifiedas 6 - E thyloct - 3 -yl- 2 - ethylhexyl ester with C hemicalformula C 26   H 42   O 4 and molecular weight 418   D a. a b c Figure 2. TLC strip visulaised in a. UV short range b. UV long rangec. I odine chamber. 4. Discussion   W orld ’ s oceans cover more than 70 % of the earth ’ s surfaceand marine biota are an enormous yet underutilized resourcefor the discovery of neutraceuticals, pharmaceuticalsand other high value, low volume bioactives [22] . M arine-derived fungi have been recognized as a potential source of structurally novel and biologically potent metabolites, anda growing number of marine fungi have been reported toproduce novel bioactive.secondary metabolites [23-35] . O f the 18   000 marine naturalproducts described, over  30 % are from sponges and of theantitumor natural product patent registrations in recentyears over  75 % are from sponges [26,27] . E specially, the genus  Aspergillus has been known to be a major contributor to thesecondary metabolites of marine fungal srcin, for example,four sesquiterpenoids with a unique nitrobenzyl ester from  Aspergillus versicolor (  A. versicolor ) , two modified cytotoxictripeptides from  Aspergillus sp., novel pentacyclic oxindolealkaloid from  Aspergillus tamari [28] , four prenylated indolealkaloids from  Aspergillus sp. [29] and two cyclopentapeptidesfrom  A. versicolor [30] . T his paper reports the isolation of threebioactive compounds from  A. ochraceus . T he antimicrobialactivities of the isolated pure compounds in ethyl acetatesolvent were reported since ethyl acetate extract showedpromising results in  Aspergillus flavus [31] . T he isolatedcompounds showed significant antimicrobial activityagainst potential human pathogens. M icrobial secondarymetabolites has a large source of compounds endowed withingenious structures and potent biological activities. M anyof the products currently used for human or animal therapy,in animal husbandry and in agriculture are producedby microbial fermentation, or derived from chemicalmodification of a microbial product [31] . T he present studyof screening bioactive secondary metabolites revealed  A.ochraceus as a source for the production of three effectivemetabolites. T hese metabolites can be further exploited
We Need Your Support
Thank you for visiting our website and your interest in our free products and services. We are nonprofit website to share and download documents. To the running of this website, we need your help to support us.

Thanks to everyone for your continued support.

No, Thanks
SAVE OUR EARTH

We need your sign to support Project to invent "SMART AND CONTROLLABLE REFLECTIVE BALLOONS" to cover the Sun and Save Our Earth.

More details...

Sign Now!

We are very appreciated for your Prompt Action!

x